View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3190_low_53 (Length: 252)
Name: NF3190_low_53
Description: NF3190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3190_low_53 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 13 - 252
Target Start/End: Original strand, 7080733 - 7080972
Alignment:
| Q |
13 |
aatattcatcatacataggaaccaaccacattgtgctatgtcaccacccctgaaacatttcaactaaattccaagtcactcttgttagcttatgctctca |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7080733 |
aatattcatcatacataggaaccaaccacattgtgctatgtcaccacccctgaaatatttcaactaaattctaagtcactcttgttagcttatgctctca |
7080832 |
T |
|
| Q |
113 |
aatttttgaccttgattccctaacatcggagaatcttgcagttatacaaatcaagacggtccaaatttaaagctcgataaataaaaagatacgttgtaaa |
212 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7080833 |
aatttttgacattgattccctaacatcggagaatcttgcacttatacaaatcaagacggtccaaatttaaagcttgataaataaaaagatacgttgtaaa |
7080932 |
T |
|
| Q |
213 |
tctcgatcaaaatcagatgatcgagattttcatgcattga |
252 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7080933 |
tcttgatcaaaatcagatgatcgagattttcatgcattga |
7080972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University