View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3190_low_55 (Length: 250)
Name: NF3190_low_55
Description: NF3190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3190_low_55 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 4 - 194
Target Start/End: Original strand, 2336810 - 2337000
Alignment:
| Q |
4 |
atctccaataatatttgcattttcttttctcaaatggatcccaactagtggaactctactataactatatgcaaaccccaatcgatgatggttctcgaaa |
103 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |
|
|
| T |
2336810 |
atctccaatcatatttgcattttcttttgtcaaatggatcccaactagtggaactctactataattatatgcaaaccccaatcgatgatggttctcgata |
2336909 |
T |
|
| Q |
104 |
tttttaatctttgacgtatctacgaccaccactccctaaagtgacagttcttaatatcccaaatcttttatgtttcaatcaacaccattcc |
194 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2336910 |
ttttcaatctttgacgtatctacgaccaccactccttaaagtgacagttcttaatatcccaaatcttttatgtttcaatcaccaccattcc |
2337000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 166 - 250
Target Start/End: Original strand, 2337029 - 2337112
Alignment:
| Q |
166 |
atcttttatgtttcaatcaacaccattccctaccgatgagagttctaaaaatctacgacattttatttttcaatcacctaacgct |
250 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2337029 |
atcttttatggtt-aatcaacaccattccctaccgatgagagttctcaaaatctacgacattttatttttcaatcacctaacgct |
2337112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University