View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3190_low_60 (Length: 246)
Name: NF3190_low_60
Description: NF3190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3190_low_60 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 34338595 - 34338365
Alignment:
| Q |
1 |
caaatcaaaaactaacaacttgagattttcgaataattggttcatgagcgttatatttctgttaaacaatcaaccatgtcaaaacaaaaataaaatgaaa |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34338595 |
caaatcaaaaaccaacaacttgagattttcgaataattggttcatgagcgttatatttctgttaaacaatcaaccatgtcaaaacaaaaataaaatgaaa |
34338496 |
T |
 |
| Q |
101 |
tactttttgcagtatttgtcatcaatgcttacagcaattgcaggttagcggggatcagcttatggaaaatggtgcatcaggaacaagtagcattgggacc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34338495 |
tactttttgcagtatttgtcatcaatgcttacagcaattgcaggttagcggggatcagcttatggaaaatggtgcatcaagaacaagtagcattgggacc |
34338396 |
T |
 |
| Q |
201 |
ttctttggttgggcaatggcagttatatatt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
34338395 |
ttctttggttgggcaatggcagttatatatt |
34338365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University