View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3190_low_62 (Length: 240)

Name: NF3190_low_62
Description: NF3190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3190_low_62
NF3190_low_62
[»] chr4 (1 HSPs)
chr4 (18-221)||(51846815-51847018)


Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 51846815 - 51847018
Alignment:
18 ggtcacttacatagggagaaaaattggatgcatgcatggctttatggaactactcgaacttctataaaccaaaaaccaaaagatgctgaagattggagtg 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
51846815 ggtcacttacatagggagaaaaattggatgcatgcatggctttatggaactgctcgaacttctataaaccaaaaaccaaaagatgctgaagattggagtg 51846914  T
118 ttttccatgttttggctccttttttgagttgaaaaatgtgaaagtacaagatcaattgaatggtgtgcctcttgtgctgtttatggcccttgtaaattaa 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
51846915 ttttccatgttttggctccttttttgagttgaaaaatgtgaaagtacaagatcaattgaatggcgtgcctcttgtgctgtttatggcccttgtaaattaa 51847014  T
218 tgtg 221  Q
    ||||    
51847015 tgtg 51847018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University