View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3190_low_66 (Length: 238)
Name: NF3190_low_66
Description: NF3190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3190_low_66 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 13 - 223
Target Start/End: Complemental strand, 39031552 - 39031340
Alignment:
| Q |
13 |
aaaaatatgtgagctttatccattatattatttgattaaaaagataaaaatattattcatcatctctcaataaaaatatggaccattgtgtatgcgggag |
112 |
Q |
| |
|
||||||||||||||| ||| ||||||| |||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39031552 |
aaaaatatgtgagctctattcattatactatttgattaaaaaaataaaaatattattcatcatctcttaataaaaatatggaccattgtgtatgcgggag |
39031453 |
T |
|
| Q |
113 |
tagagaaagatggggtcacgaggtgaaggtaacattacattacttttgaagtgcatcattaacaa--acactttgttaaaagatagagattattaattga |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
39031452 |
tagagaaagatggggtcacgaggtgaaggtaacattacattacttttgaagtgcatcattaacaatgacactttgttaaaagatagagattattagttga |
39031353 |
T |
|
| Q |
211 |
tttatggggtgtg |
223 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
39031352 |
tttatgggatgtg |
39031340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University