View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3190_low_67 (Length: 236)
Name: NF3190_low_67
Description: NF3190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3190_low_67 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 31156829 - 31157049
Alignment:
| Q |
1 |
aagaatgactggaatgatgacaaatgaaaacaagtgactattactattagaaaatcttagctctattttgggtctccatgcacatgttgtcgtagttgga |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31156829 |
aagaatgactggaatgatgataaatgaaaacaagtgactattactattagaaaatcttagctctattttgggtctccgtgcacatgttgtcgtagttgga |
31156928 |
T |
 |
| Q |
101 |
tcaacaggtgcaacggagaatactgcacaacaagcaatgccaatgaaatcattgtcattgttgtccataatctgagatatgtccattcttattgaatcac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31156929 |
tcaacaggtgcaacggagaatactgcacaacaagcaatgccaatgaaatcattgtcattgttgtccataatctgagataggtccattcttattgaatcac |
31157028 |
T |
 |
| Q |
201 |
cctcgctctgattgttgaacc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
31157029 |
cctcgctctgattgttgaacc |
31157049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 107 - 157
Target Start/End: Original strand, 31148006 - 31148056
Alignment:
| Q |
107 |
ggtgcaacggagaatactgcacaacaagcaatgccaatgaaatcattgtca |
157 |
Q |
| |
|
|||| |||||| ||||| ||||| ||||||||||||||||||| ||||||| |
|
|
| T |
31148006 |
ggtgaaacggaaaataccgcacagcaagcaatgccaatgaaattattgtca |
31148056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University