View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3190_low_72 (Length: 233)
Name: NF3190_low_72
Description: NF3190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3190_low_72 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 1876222 - 1876435
Alignment:
| Q |
1 |
tgaaatcaaaattgtccagtcctaactgaattaccgacactctattgattgcatgaatgcatgggatttgtgatgacaagccaaatccccataaaagtac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1876222 |
tgaaatcaaaattgtccagtcctaactgaattaccgacactgtattgattgcatgaatgtgtgggatttgtgatgacaagccaaatccccataaaagtac |
1876321 |
T |
|
| Q |
101 |
ctagcaaatgtagctctgaaaagtcttcaataaaatgtttgttgttattagttatctattttagtattgtaaaagtggctgcaacaataacataatagtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1876322 |
ctagcaaatgtagctctgaaaagtcttcaataaaatgtttgttgttattagttatctattttagtattgtaaaagtggctgcaacaataacataatagtt |
1876421 |
T |
|
| Q |
201 |
cttgaggtctttgc |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
1876422 |
cttgaggtctttgc |
1876435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University