View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3190_low_74 (Length: 228)
Name: NF3190_low_74
Description: NF3190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3190_low_74 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 26738349 - 26738291
Alignment:
| Q |
1 |
ctatgatacatttcatttagtggaaatgaatctgtagtgactatgaaacatatatcaat |
59 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26738349 |
ctatcatacatttcatttagtggaaatgaatctttagtgactatgaaacatatatcaat |
26738291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 127 - 162
Target Start/End: Complemental strand, 26738218 - 26738183
Alignment:
| Q |
127 |
gcatactaacaaatccacaatcatagctcaaatggt |
162 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26738218 |
gcatactaacaagtccacaatcatagctcaaatggt |
26738183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University