View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3190_low_79 (Length: 221)
Name: NF3190_low_79
Description: NF3190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3190_low_79 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 45955001 - 45955228
Alignment:
| Q |
1 |
tttcgagagtattatatagtctagtcagctcaactcaacaagacaaa-----atacaagtatttatcaagcaacgtc---tatgtagcatcaacattgtg |
92 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
45955001 |
tttcgagagtat-atatagtctagtcagctcaactcaacaagacaaattaaaatacaagtattgatcaagcaacgtcgtctatgtagcatcaacattgtg |
45955099 |
T |
|
| Q |
93 |
attgcaatgcatgaaatgaaagtgattatgatgtgtaaatagagagaatgaaaagagtgtagaacctgaatttgagtttgaagtcttgctccattgaaat |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45955100 |
attgcaatgcatgaaatgaaagtgattatgatgtgtaaatagagagaatgaaaagagtgtagaacctgaatatgagtttgaagtcttgctccattgaaat |
45955199 |
T |
|
| Q |
193 |
cagaaagagaagaagctaaaggagggaaa |
221 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45955200 |
cagaaagagaagaagctaaaggagggaaa |
45955228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University