View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3196_high_32 (Length: 238)
Name: NF3196_high_32
Description: NF3196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3196_high_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 4713351 - 4713404
Alignment:
| Q |
18 |
tttcactgcttcttcaaaaccatcttcaatctctctcaattcctccaaatttcg |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4713351 |
tttcactgcttcttcaaaaccatcttcaatctctctcaattcctccaaatttcg |
4713404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 183 - 238
Target Start/End: Original strand, 4713504 - 4713559
Alignment:
| Q |
183 |
gtaataaacatacttgtactgttaattttgcaattcatgcctcaaacattgttcaa |
238 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4713504 |
gtaataaacatacctgtactgttaatttttcaattcatgcctcaaacattgttcaa |
4713559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University