View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3196_low_16 (Length: 329)
Name: NF3196_low_16
Description: NF3196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3196_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 18 - 304
Target Start/End: Complemental strand, 15380577 - 15380293
Alignment:
| Q |
18 |
atattatttccctttctcactctctacatgtctctcattcactttccctagggaatctgcaaagccattgctgaatgactatacccaccaacaagnnnnn |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15380577 |
atattatttccctttctcactctctacatgtctctcattcactttccctagggaatctgcaaagccattgctgaatgactatacccaccaacaagtaata |
15380478 |
T |
 |
| Q |
118 |
nnnnnnnnnnnnnnnnnnnaagctcacaactctcatgcaatattgtagtaatgtgccccatgactcttaagtcaattatgaaactcaaaaaccttctata |
217 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15380477 |
ataataacaataataataaaagctcacaactcttatgcaatattgtagtaatgtgccccatgactct-aagtcaattatgaaactcaaaaaccttctata |
15380379 |
T |
 |
| Q |
218 |
ataaaattttgaggtttctggacaaacttggaccaccaccttatttattttaagnnnnnnnncttcctttattagtactactgttca |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15380378 |
ataaaattttgaggtttctggacaaacttggaccaccaccttatttattttaag-tttttttcttcctttattagtactactgttca |
15380293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University