View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3196_low_23 (Length: 276)
Name: NF3196_low_23
Description: NF3196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3196_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 11 - 93
Target Start/End: Complemental strand, 27652337 - 27652254
Alignment:
| Q |
11 |
cataggtctaatagaaaattgggaagggttagctgtttttacatt-nnnnnnnnctcgctactggttggatgtttctttcgtta |
93 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27652337 |
cataggtctaatagaaaattgggaatggttagctgtttttacattaaaaaaaaactcgctactggttggatgtttctttcgtta |
27652254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University