View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3196_low_26 (Length: 252)
Name: NF3196_low_26
Description: NF3196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3196_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 16 - 236
Target Start/End: Complemental strand, 28600853 - 28600630
Alignment:
| Q |
16 |
tcatccaaatatttctataatcattttacatgtcaaatacaactcttccaaagatcatgtttataccctccgtaagtttcttatttgtgtttaggt---- |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28600853 |
tcatccaaatatttctataatcattttacatgtcaaatacaactcttccaaagatcatgtttataccctccgtaagtttcttatttgtgtttaggtaaaa |
28600754 |
T |
 |
| Q |
112 |
-nnnnnnnnnnngttttcatcatttatattgtgatttatannnnnnnnnnnnnnngcagttggaaaactccctgcaaaaggtgcatgtgaagagacacta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28600753 |
aaaaaaaaaaatgttttcatcatttatattgtgatttata--ttttttattttttgcagttggaaaactccctgcaaaaggtgcatgtgaagagacacta |
28600656 |
T |
 |
| Q |
211 |
gaacgtataagaaaatatgaggaaac |
236 |
Q |
| |
|
||||||||||| |||||||||||||| |
|
|
| T |
28600655 |
gaacgtataaggaaatatgaggaaac |
28600630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University