View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3196_low_32 (Length: 238)

Name: NF3196_low_32
Description: NF3196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3196_low_32
NF3196_low_32
[»] chr2 (2 HSPs)
chr2 (18-71)||(4713351-4713404)
chr2 (183-238)||(4713504-4713559)


Alignment Details
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 4713351 - 4713404
Alignment:
18 tttcactgcttcttcaaaaccatcttcaatctctctcaattcctccaaatttcg 71  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4713351 tttcactgcttcttcaaaaccatcttcaatctctctcaattcctccaaatttcg 4713404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 183 - 238
Target Start/End: Original strand, 4713504 - 4713559
Alignment:
183 gtaataaacatacttgtactgttaattttgcaattcatgcctcaaacattgttcaa 238  Q
    ||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||    
4713504 gtaataaacatacctgtactgttaatttttcaattcatgcctcaaacattgttcaa 4713559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University