View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3196_low_38 (Length: 221)
Name: NF3196_low_38
Description: NF3196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3196_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 18 - 203
Target Start/End: Original strand, 40676190 - 40676375
Alignment:
| Q |
18 |
acattttgcgtgacattttacaatttctaaaatgtatatgccaattagaaaaattgagaaattatttcaatcatacttacagtttcggtgactaatctgc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40676190 |
acattttgcgtgacattttacaatttctaaaatgtatatgccaattcgaaaaattgagaaattatttcaatcatacttacagtttcggtgactaatctgc |
40676289 |
T |
|
| Q |
118 |
tgattcagttttttagttattgagcagcaagaacatttaactgtaaattagtatatcactgtaataacagtataacatttgatttt |
203 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40676290 |
tgattcatttttttaggtattgagcagcaagaacatttaactgtaaattagtatatcactgtaataacagtataacatttgatttt |
40676375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University