View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3198_high_28 (Length: 299)
Name: NF3198_high_28
Description: NF3198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3198_high_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 14 - 209
Target Start/End: Original strand, 6504689 - 6504882
Alignment:
| Q |
14 |
gaagtacaagagaaatgaacacttgcggtggtaatgatgatatatacacaatgagacaagtgttggaagataaaatattatagaaattggaatttgttga |
113 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6504689 |
gaagtacaagagaaatgaacacttgcgatggtaatgatgatatatacacaatgagacaagtgttggaagataaaatattatagaaattggaa-ttgttga |
6504787 |
T |
 |
| Q |
114 |
ccttttaaactcacaccttgtaggaaacacccttcaaaaagaatccgtgggaaacatgttatcnnnnnnnnaaggaaggagtcacagtaatatgaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6504788 |
ccttttaaactcacaccttgtaggaaacatccttaaaaaagaatccgtggaaaacatgttatctttttttt-aggaaggagtcacagtaatatgaa |
6504882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 211 - 299
Target Start/End: Original strand, 6504919 - 6505007
Alignment:
| Q |
211 |
tttccacactaataggattcgagttcgataagatccatcataatgacaatttattaactatttgggttaaatcacttggttacaaatgt |
299 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
6504919 |
tttccacactaataggattcgagtttgataagatccatcataatgacaatttattaatcatttgagttaaatcacttggttataaatgt |
6505007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University