View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3198_high_38 (Length: 252)
Name: NF3198_high_38
Description: NF3198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3198_high_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 18245661 - 18245905
Alignment:
| Q |
1 |
ttgcaaaacaccatcaaaagtaaccgaaaatgacttcgcctaccacggcctagctgcagccggaaacacctcaaacattatcaaagcagctgtgacccct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18245661 |
ttgcaaaacaccatcaaaagtaaccgaaaatgacttcgcctaccacggcctagctgcagccggaaacacctcaaacattatcaaagcagctgtgacccct |
18245760 |
T |
 |
| Q |
101 |
gcattcgacgcgcaatttgctggtttaaacggtcttggaatttcccttgcgcgtttagatttagccgcaggtggagttattccacttcacactcaccccg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18245761 |
gcattcgacgcgcaatttgctggtttaaacggtcttggaatttcccttgcgcgtttagatttagccgcaggtggagttattccacttcacactcaccccg |
18245860 |
T |
 |
| Q |
201 |
gtgcttcggaggtgttggttgttattcaaggaacaatctgtgctg |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18245861 |
gtgcttcggaggtgttggttgttattcaaggaacaatctgtgctg |
18245905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 18252765 - 18253009
Alignment:
| Q |
1 |
ttgcaaaacaccatcaaaagtaaccgaaaatgacttcgcctaccacggcctagctgcagccggaaacacctcaaacattatcaaagcagctgtgacccct |
100 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||| ||||||||||||||| ||||| ||||||||| |||||||||||||||| ||||| ||| || |
|
|
| T |
18252765 |
ttgcaaaccaccatcaaaagtaaccgtgaatgacttcgtctaccacggcctagccgcagctggaaacaccacaaacattatcaaagccgctgttaccact |
18252864 |
T |
 |
| Q |
101 |
gcattcgacgcgcaatttgctggtttaaacggtcttggaatttcccttgcgcgtttagatttagccgcaggtggagttattccacttcacactcaccccg |
200 |
Q |
| |
|
||| | ||||| |||||| | ||| |||||||||||||||||||| |||| ||||||||| |||||| ||||| ||||||||||||||||| ||||||| |
|
|
| T |
18252865 |
gcaatagacgcacaatttcccggtgtaaacggtcttggaatttccattgctcgtttagatatagccgttggtggtgttattccacttcacacacaccccg |
18252964 |
T |
 |
| Q |
201 |
gtgcttcggaggtgttggttgttattcaaggaacaatctgtgctg |
245 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||| |||||| |
|
|
| T |
18252965 |
gtgcttcggaagtgttggttgttattaaaggaacaatcagtgctg |
18253009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 18256803 - 18256559
Alignment:
| Q |
1 |
ttgcaaaacaccatcaaaagtaaccgaaaatgacttcgcctaccacggcctagctgcagccggaaacacctcaaacattatcaaagcagctgtgacccct |
100 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||| ||||||||||||||| ||||| ||||||||| |||||||||||||||| ||||| ||| || |
|
|
| T |
18256803 |
ttgcaaaccaccatcaaaagtaaccgtgaatgacttcgtctaccacggcctagccgcagctggaaacaccacaaacattatcaaagccgctgttaccact |
18256704 |
T |
 |
| Q |
101 |
gcattcgacgcgcaatttgctggtttaaacggtcttggaatttcccttgcgcgtttagatttagccgcaggtggagttattccacttcacactcaccccg |
200 |
Q |
| |
|
||| | ||||| |||||| | ||| |||||||||||||||| ||| |||| ||||||||| |||||| |||||| ||||||||||||||||| ||||||| |
|
|
| T |
18256703 |
gcaatagacgcacaatttcccggtgtaaacggtcttggaatatccattgcacgtttagatatagccgtaggtggtgttattccacttcacacacaccccg |
18256604 |
T |
 |
| Q |
201 |
gtgcttcggaggtgttggttgttattcaaggaacaatctgtgctg |
245 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||| |||||| |
|
|
| T |
18256603 |
gtgcttcggaagtgttggttgttattaaaggaacaatcagtgctg |
18256559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University