View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3198_high_40 (Length: 249)
Name: NF3198_high_40
Description: NF3198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3198_high_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 8 - 64
Target Start/End: Complemental strand, 23852696 - 23852640
Alignment:
| Q |
8 |
attatactctctacggtctcaattataagcaacctttcatattttggttcattgaat |
64 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23852696 |
attatactctcatcggtctcaattataagcaacctttcatatttaggttcattgaat |
23852640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 68 - 196
Target Start/End: Complemental strand, 23852475 - 23852355
Alignment:
| Q |
68 |
tttcttgactaaagaaattgattttattcta-ttttgttgttagtatctccattttctgcaaaactattgaatcaaaatttaatttttactactagtagt |
166 |
Q |
| |
|
|||||||||||||| |||||||| |||||| ||||||||| | || |||| ||||||||||| |||||||| ||| |||||||| ||||| |
|
|
| T |
23852475 |
tttcttgactaaagtaattgattcaattctagttttgttgtcggcatttccagtttctgcaaaagtattgaatgaaattttaattt---------gtagt |
23852385 |
T |
 |
| Q |
167 |
aaaggaaatatgataacaggaattctaaac |
196 |
Q |
| |
|
||||||||||||||| ||||||| |||||| |
|
|
| T |
23852384 |
aaaggaaatatgatagcaggaatcctaaac |
23852355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University