View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3198_high_49 (Length: 226)
Name: NF3198_high_49
Description: NF3198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3198_high_49 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 38719647 - 38719463
Alignment:
| Q |
18 |
ctaccaaacgttgttgcttttgtttgttatattttctgtcgttgaatttgtcttgccttttctttagtttgtggtgatgaatgaatgcctcttagaccat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38719647 |
ctaccaaacgttgttgcttttgtttgttatattttctgtcgttgaatttgtcttgtcttttctttagtttgtggtaatgaatgaatgcctcttagaccat |
38719548 |
T |
 |
| Q |
118 |
ttcattatattgtttgaattttaaggaatataatttattaatactttgaaaattgtgctgttatttattttaattttgattctta |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38719547 |
ttcattatattgtttgaattttaaggaatataatttattaatactttgaaaattgtgctgttatttattttaattttgattctta |
38719463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University