View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3198_low_33 (Length: 280)
Name: NF3198_low_33
Description: NF3198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3198_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 16 - 274
Target Start/End: Complemental strand, 33830169 - 33829911
Alignment:
| Q |
16 |
acaaactacggtggcttggctaacaagttaccctatgatcaagttaatctctagctgactaactcaattatttagctaacttgtattttaagcaactaac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33830169 |
acaaactacggtggcttggctaacaagttaccctatgatcaagttaatctctagctgactaactcaattatttagctaacttgtatcttaagcaactaac |
33830070 |
T |
 |
| Q |
116 |
aaactaactgcttatagtttgaattatacaactaacagttttttgcttgaatggaagcacacggagccttcacgttcttcgtgatgaatattatcgggat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33830069 |
aaactaactgcttatagtttgaattatacaactaacagttttttgcttgaatggaagcatacggagccttcacgttcttcgtgatgaatattatcgggat |
33829970 |
T |
 |
| Q |
216 |
ctacatcattgtgtctgtcttgtttataatctgagtaaaatgttgatttgtttctctgc |
274 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33829969 |
ctacatcattgtgtgtgtcttgtttataatcagagtaaaatgttgatttgtttctctgc |
33829911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 16 - 274
Target Start/End: Original strand, 33837797 - 33838055
Alignment:
| Q |
16 |
acaaactacggtggcttggctaacaagttaccctatgatcaagttaatctctagctgactaactcaattatttagctaacttgtattttaagcaactaac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33837797 |
acaaactacggtggcttggctaacaagttaccctatgatcaagttaatctctagctgactaactcaattatttagctaacttgtatcttaagcaactaac |
33837896 |
T |
 |
| Q |
116 |
aaactaactgcttatagtttgaattatacaactaacagttttttgcttgaatggaagcacacggagccttcacgttcttcgtgatgaatattatcgggat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33837897 |
aaactaactgcttatagtttgaattatacaactaacagttttttgcttgaatggaagcatacggagccttcacgttcttcgtgatgaatattatcgggat |
33837996 |
T |
 |
| Q |
216 |
ctacatcattgtgtctgtcttgtttataatctgagtaaaatgttgatttgtttctctgc |
274 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33837997 |
ctacatcattgtgtgtgtcttgtttataatcagagtaaaatgttgatttgtttctctgc |
33838055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 53 - 150
Target Start/End: Complemental strand, 33087495 - 33087392
Alignment:
| Q |
53 |
atcaagttaatct----ctagctgactaactca--attatttagctaacttgtattttaagcaactaacaaactaactgcttatagtttgaattatacaa |
146 |
Q |
| |
|
||||||||||||| |||||| ||||||||| |||||| ||||||||||| ||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
33087495 |
atcaagttaatctctaactagctaactaactcagtcttatttcgctaacttgtagcttaagcaacgaacaaactaattgcttatagtttgaattatacaa |
33087396 |
T |
 |
| Q |
147 |
ctaa |
150 |
Q |
| |
|
|||| |
|
|
| T |
33087395 |
ctaa |
33087392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University