View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3198_low_42 (Length: 244)
Name: NF3198_low_42
Description: NF3198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3198_low_42 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 139 - 242
Target Start/End: Complemental strand, 5522951 - 5522848
Alignment:
| Q |
139 |
ataagcaaaggtgaaacattgaagattaatctttggagattacataccatgctctcggactccatgtgcaaaactgtcaccctttcttccaaacatgttc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5522951 |
ataagcaaaggtgaaacattgaagattaatctttggagattacataccatgctcttggactccatgtgcaaaactgtcaccctttcttccaaacatgttc |
5522852 |
T |
|
| Q |
239 |
atct |
242 |
Q |
| |
|
|||| |
|
|
| T |
5522851 |
atct |
5522848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 51753815 - 51753886
Alignment:
| Q |
1 |
tttactgtatctgttatctttggtcctaatctcactgcaggttacaataacagtttcaagccatcagttaca |
72 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||| || |||||||||||||||| ||||| |||| |
|
|
| T |
51753815 |
tttactgtatctgttatctttggtccaagtctcactgcagggtaaaataacagtttcaagctatcaggtaca |
51753886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 140 - 242
Target Start/End: Original strand, 51753992 - 51754094
Alignment:
| Q |
140 |
taagcaaaggtgaaacattgaagattaatctttggagattacataccatgctctcggactccatgtgcaaaactgtcaccctttcttccaaacatgttca |
239 |
Q |
| |
|
|||||||| |||||| ||||||||| |||| ||||||||||||||||||||||| ||||||||||||| ||| | ||||||||||||||||||| |
|
|
| T |
51753992 |
taagcaaaagtgaaaaattgaagataggtcttccaagattacataccatgctctcggataccatgtgcaaaaccatcatcttttcttccaaacatgttca |
51754091 |
T |
|
| Q |
240 |
tct |
242 |
Q |
| |
|
||| |
|
|
| T |
51754092 |
tct |
51754094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University