View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3198_low_44 (Length: 240)
Name: NF3198_low_44
Description: NF3198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3198_low_44 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 18245521 - 18245299
Alignment:
| Q |
1 |
tgtgtttttgtggtcaatttggttctactatatatagagagtggaatggtgaatatgttattactattgttattgaataatgttgaatttattcaacatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18245521 |
tgtgtttttgtggtcaatttggttctactatatatagagagtggaatggtgaatatgttattactattgttattgaataatgttgaatttattcaacatg |
18245422 |
T |
|
| Q |
101 |
gattgannnnnnngttgaaaggatagatattttgaggtaggatttgttgttcacgtgaatgttgaacttttttcctttggataacaacaagaagtgtctt |
200 |
Q |
| |
|
||| || |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
18245421 |
gatagatttttttgttgaaaggatagatattttgaggtaggatttgttgttcacgtgaatgatgaacttttttcctttgaataacaacaataagtgtctt |
18245322 |
T |
|
| Q |
201 |
tttgtttgaatccaggacaatag |
223 |
Q |
| |
|
||||||||||| ||||||||||| |
|
|
| T |
18245321 |
tttgtttgaattcaggacaatag |
18245299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 18252622 - 18252576
Alignment:
| Q |
1 |
tgtgtttttgtggtcaatttggttctactatatatagagagtggaat |
47 |
Q |
| |
|
||||| ||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
18252622 |
tgtgtatttgtggtcaaattggttctattatatatagagagtggaat |
18252576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 18256946 - 18256992
Alignment:
| Q |
1 |
tgtgtttttgtggtcaatttggttctactatatatagagagtggaat |
47 |
Q |
| |
|
||||| ||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
18256946 |
tgtgtatttgtggtcaaattggttctattatatatagagagtggaat |
18256992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University