View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3198_low_46 (Length: 237)

Name: NF3198_low_46
Description: NF3198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3198_low_46
NF3198_low_46
[»] chr8 (2 HSPs)
chr8 (123-192)||(38280720-38280789)
chr8 (1-42)||(38280866-38280907)


Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 123 - 192
Target Start/End: Complemental strand, 38280789 - 38280720
Alignment:
123 gtacaatgataaaagtggggatgtgtatttattggcaataaataaatgggtattttgtcttttgtattta 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38280789 gtacaatgataaaagtggggatgtgtatttattggcaataaataaatgggtattttgtcttttgtattta 38280720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 38280907 - 38280866
Alignment:
1 tagttttgtcttttgtgtatatactctatttttagtacaatg 42  Q
    ||||||||||||||||||||||||||||||||||||||||||    
38280907 tagttttgtcttttgtgtatatactctatttttagtacaatg 38280866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University