View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3198_low_50 (Length: 230)
Name: NF3198_low_50
Description: NF3198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3198_low_50 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 17 - 172
Target Start/End: Original strand, 488740 - 488895
Alignment:
| Q |
17 |
tgagattgttatcaaaggaacttccatttgcatagatgtttcttgtggagcaaatttcatatggaggatctgctaaggcaagatatgaaagaaaatcaag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
488740 |
tgagattgttatcaaaggaacttccatttgcatagatgtttcttgtggaacaaatttcatatggaggatctgctaaggcaagatatgaaagaaaatcaag |
488839 |
T |
|
| Q |
117 |
agtgcaaagaacaagaaaaaattgaatgaatttgaaaactataggataatgaaaca |
172 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
488840 |
agtgtaaagaacaaggaaaaattgaatgaatttgaaaactataggataatgaaaca |
488895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University