View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3198_low_52 (Length: 224)

Name: NF3198_low_52
Description: NF3198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3198_low_52
NF3198_low_52
[»] chr7 (2 HSPs)
chr7 (131-224)||(45659365-45659458)
chr7 (1-81)||(45659489-45659569)
[»] chr1 (1 HSPs)
chr1 (1-37)||(37983881-37983917)


Alignment Details
Target: chr7 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 131 - 224
Target Start/End: Complemental strand, 45659458 - 45659365
Alignment:
131 gtttagaatctcattcatgtgtctattgtttaggacttaccagaacttctagagatccaaaaagcaagcaagtggtgaatctatttaagtaagt 224  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45659458 gtttagaatctcattcatgtgtctattgtttaggacttaccagaacttctagagatccaaaaagcaagcaagtggtgaatctatttaagtaagt 45659365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 45659569 - 45659489
Alignment:
1 acacaacttgatttcccacatgcatttggatgtaaatgatctgaagcagcttgaaaagtaaccaatgccaaagcctacaaa 81  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45659569 acacaacttgatttcccacatgcatttggatgtaaatgatctgaagcagcttgaaaagtaaccaatgccaaagcctacaaa 45659489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 37983881 - 37983917
Alignment:
1 acacaacttgatttcccacatgcatttggatgtaaat 37  Q
    |||||||||||||| |||||||| |||||||||||||    
37983881 acacaacttgatttaccacatgcttttggatgtaaat 37983917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University