View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3198_low_52 (Length: 224)
Name: NF3198_low_52
Description: NF3198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3198_low_52 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 131 - 224
Target Start/End: Complemental strand, 45659458 - 45659365
Alignment:
| Q |
131 |
gtttagaatctcattcatgtgtctattgtttaggacttaccagaacttctagagatccaaaaagcaagcaagtggtgaatctatttaagtaagt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45659458 |
gtttagaatctcattcatgtgtctattgtttaggacttaccagaacttctagagatccaaaaagcaagcaagtggtgaatctatttaagtaagt |
45659365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 45659569 - 45659489
Alignment:
| Q |
1 |
acacaacttgatttcccacatgcatttggatgtaaatgatctgaagcagcttgaaaagtaaccaatgccaaagcctacaaa |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45659569 |
acacaacttgatttcccacatgcatttggatgtaaatgatctgaagcagcttgaaaagtaaccaatgccaaagcctacaaa |
45659489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 37983881 - 37983917
Alignment:
| Q |
1 |
acacaacttgatttcccacatgcatttggatgtaaat |
37 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
37983881 |
acacaacttgatttaccacatgcttttggatgtaaat |
37983917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University