View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3198_low_56 (Length: 204)
Name: NF3198_low_56
Description: NF3198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3198_low_56 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 44 - 192
Target Start/End: Original strand, 47145376 - 47145524
Alignment:
| Q |
44 |
tatagccatagtattacactagatttggaattatttccaatcatttcaattcaattattcactttccacttctgcctaaatggctgtttctcctgtttgt |
143 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47145376 |
tatagccataggattagactagatttggaattatttccaatcaattcaattcaattattcactttccacttctgcctaaatggctgtttctcctgtttgt |
47145475 |
T |
 |
| Q |
144 |
gccaattgaattcaattcaattacccaacattttagaggctgatattct |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47145476 |
gccaattgaattcaattcaattacccaacattttagaggctgattttct |
47145524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University