View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3201_high_5 (Length: 272)
Name: NF3201_high_5
Description: NF3201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3201_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 37 - 259
Target Start/End: Complemental strand, 31952747 - 31952523
Alignment:
| Q |
37 |
atgattgaaagaaactgtctcatatgatagaattaatgtgacaaatattgt--gttctgtgtgattggttagtttggagatgttcttggaaaaggggcaa |
134 |
Q |
| |
|
||||||||||||||| ||||||||| || |||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31952747 |
atgattgaaagaaaccgtctcatataatggaattaatgtgacaaatattgtatgttctgtgtgattgattagtttggagatgttcttggaaaaggggcaa |
31952648 |
T |
 |
| Q |
135 |
tgaagacagtatacaaagcaattgatgaagtacttggaatagaggtagcatggaaccaagtcagactcaacgaggtactaaacacgccggacgatttgca |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31952647 |
tgaagacagtatacaaagcaattgatgaagtacttggaatagaggtagcatggaaccaagtcagactcaacgaggtactaaacacgccggacgatttgca |
31952548 |
T |
 |
| Q |
235 |
gcgcctttactcggaggttcatctc |
259 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
31952547 |
gcgcctttactcggaggttcatctc |
31952523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 108 - 204
Target Start/End: Complemental strand, 5952362 - 5952266
Alignment:
| Q |
108 |
ttggagatgttcttggaaaaggggcaatgaagacagtatacaaagcaattgatgaagtacttggaatagaggtagcatggaaccaagtcagactcaa |
204 |
Q |
| |
|
|||||| | |||||||||||||||||||||| | ||| || ||||| |||||| | || ||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
5952362 |
ttggaggtattcttggaaaaggggcaatgaaaatagtgtataaagccattgataaggtccttggaatagaaatagcatggaaccaagtcaaactcaa |
5952266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 168 - 209
Target Start/End: Complemental strand, 22397380 - 22397339
Alignment:
| Q |
168 |
ttggaatagaggtagcatggaaccaagtcagactcaacgagg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
22397380 |
ttggaatagaggtagcatggaaccaagtcaaactcaatgagg |
22397339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University