View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3201_low_4 (Length: 425)
Name: NF3201_low_4
Description: NF3201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3201_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 384; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 384; E-Value: 0
Query Start/End: Original strand, 16 - 415
Target Start/End: Original strand, 29297743 - 29298142
Alignment:
| Q |
16 |
ataatttgtaactcaactcaacccttcatgtttatatatgtgcaggtgtttgaggaagttcattgatcacatattcttgaactaagatgaataaatcatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29297743 |
ataatttgtaactcaactcaaccctttatgtttatatatgtgcaggtgtttgaggaagttcattgatcacatattcttgaactaagatgaataaatcatt |
29297842 |
T |
 |
| Q |
116 |
caagtttggtgaaatttctgatgtggagtatcatccttcaccttcaatggatcatcatttaatcagtgacactcctgctttttctagattgagtggtgat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29297843 |
caagtttggtgaaatttctgatgtggagtatcatccttcaccttcaatggatcatcatttagtcagtgacactcctgctttttctagattgagtggtgat |
29297942 |
T |
 |
| Q |
216 |
tctttcggatactgccgagtttggacgagttcggatgcatcaaactcaaacttctcagattctgtagatgatagcagctatgccagtgaatcttcacctt |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29297943 |
tctttcggatactgccgagtttggacgagttcggatgcatcaaactcaaacttctcagattctgtagatgatagcagctatgccagtgaatcttcgcctt |
29298042 |
T |
 |
| Q |
316 |
tgccttcgccttcgccttctcggtggagagaggctaaacctggtctttctaggttaggaatgaagctacgcaagcattcgatcgatgacaaacttgatga |
415 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29298043 |
tgccttcgccttcaccttctcggtggagagaggctaaacctggtctttctaggttaggaatgaagctacgcaagcattcgatcgatgacaaacttgatga |
29298142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University