View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3201_low_8 (Length: 250)
Name: NF3201_low_8
Description: NF3201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3201_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 7 - 240
Target Start/End: Original strand, 30921523 - 30921756
Alignment:
| Q |
7 |
ctatcatgtttcattttccttaaattagacgaagaaaaacccattcacaagtactagcttgatagaagttctttgcaagggagagaggttggaagaagct |
106 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30921523 |
ctatcatgtttcattttccttacattagacgaagaaaaacccattcacaagtactagcttgatagaagttctttgcaagggagagaggttggaagaagct |
30921622 |
T |
 |
| Q |
107 |
attgattatctcaaagccaaaaaatgttcgaaaattttggcaatgtgggacttcatgcctactgtggatttgtctatcgtggactctgactctgtccaat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30921623 |
attgattatctcaaagccaaaaaatgttcgaaaattttggcaatgtgggacttcatgcctactgtggatttgtctatcgtggactctgactctgtccaat |
30921722 |
T |
 |
| Q |
207 |
taatatcaacattgttgtctttgacctacctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30921723 |
taatatcaacattgttgtctttgacctacctttg |
30921756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University