View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3202_high_4 (Length: 389)
Name: NF3202_high_4
Description: NF3202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3202_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 8e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 8e-80
Query Start/End: Original strand, 188 - 374
Target Start/End: Complemental strand, 42190434 - 42190245
Alignment:
| Q |
188 |
aggagtaatctaagttaattacttatacataccttattttggtcaca--gttttcagcctaatcaactttaccaatttaaaaatgtagaaggtttggact |
285 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
42190434 |
aggagaaatcgaagttaattacttatacataccttattttggtcacatagttttcagcctaatcaactttaccaatttaaaactttagaaggtttggact |
42190335 |
T |
|
| Q |
286 |
taaaagcttatcacatttgagtttcatacctaaagtcactctatggctttcatgaagccaaactt-agagacttatcgtgatttcaaatt |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
42190334 |
taaaagcttatcacatttgagtttcatacctaaagtcactctatggctttcatgaagccaaacttaagagacttatcatgatttcaaatt |
42190245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 2 - 66
Target Start/End: Complemental strand, 42190644 - 42190580
Alignment:
| Q |
2 |
catgataattttcagggttgagaatgtnnnnnnntatgctaattgttggcggccaactctcgggt |
66 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
42190644 |
catgataattttcagggttgagaatgtaaaaaaatatgctaattgttagcggccaactctcgggt |
42190580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University