View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3202_high_7 (Length: 259)

Name: NF3202_high_7
Description: NF3202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3202_high_7
NF3202_high_7
[»] chr3 (1 HSPs)
chr3 (7-243)||(48239007-48239242)


Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 7 - 243
Target Start/End: Original strand, 48239007 - 48239242
Alignment:
7 aaaacaagagaggaacgaggaaaggaagaaaatgaagatgggcaaaaacagaaaccccatggtgacatgaaaattgatgaaaattaaaacaaacacaact 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||    
48239007 aaaacaagagaggaacgaggaaaggaagaaaatgaagatgggcaaaaacagaaatcccatggtgacatgaaaattgatgaaaactaaaacaaacacaact 48239106  T
107 aacgtttctaatgtgtcgtgttctataccgttgannnnnnnnagtttaaattttaatttagacatttctggttgtgaccaacccttgatggtcccaaata 206  Q
    ||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
48239107 aacgtttctaatgtgtcgtgttctataccgttga-tttttttagtttaaattttaatttagacatttctcgttgtgaccaacccttgatggtcccaaata 48239205  T
207 aactttaccaactactactcttgagattggatttcat 243  Q
    |||||||||||||||||| ||||||||| ||||||||    
48239206 aactttaccaactactacccttgagattagatttcat 48239242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University