View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3202_low_10 (Length: 223)
Name: NF3202_low_10
Description: NF3202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3202_low_10 |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0007 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 17 - 206
Target Start/End: Original strand, 220104 - 220293
Alignment:
| Q |
17 |
gagatgaactcaaaaaactctccaattctaagatggaaaatattgagagcaaccatgcatcatgcaatttaaatgttcaacagaataatggtattttgag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
220104 |
gagatgaactcaaaaaactctccaattctaagctggaaaatattgagagcaaccatgcatcatgcaatttaaatgttcaacagaataatggtattttgag |
220203 |
T |
 |
| Q |
117 |
aattgaatttacaagtggcttaagagaggaaaggctcaaactttcacagttgctaaattttttggctaaagagggatttgaagttgatag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
220204 |
aattgaatttacaagtggcttaagagaggaaaagctcaaactttcacagttgctaaattttttggctaaagagggatttgaagttgatag |
220293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University