View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3202_low_8 (Length: 259)
Name: NF3202_low_8
Description: NF3202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3202_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 7 - 243
Target Start/End: Original strand, 48239007 - 48239242
Alignment:
| Q |
7 |
aaaacaagagaggaacgaggaaaggaagaaaatgaagatgggcaaaaacagaaaccccatggtgacatgaaaattgatgaaaattaaaacaaacacaact |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48239007 |
aaaacaagagaggaacgaggaaaggaagaaaatgaagatgggcaaaaacagaaatcccatggtgacatgaaaattgatgaaaactaaaacaaacacaact |
48239106 |
T |
|
| Q |
107 |
aacgtttctaatgtgtcgtgttctataccgttgannnnnnnnagtttaaattttaatttagacatttctggttgtgaccaacccttgatggtcccaaata |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48239107 |
aacgtttctaatgtgtcgtgttctataccgttga-tttttttagtttaaattttaatttagacatttctcgttgtgaccaacccttgatggtcccaaata |
48239205 |
T |
|
| Q |
207 |
aactttaccaactactactcttgagattggatttcat |
243 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
48239206 |
aactttaccaactactacccttgagattagatttcat |
48239242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University