View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3206_high_12 (Length: 346)
Name: NF3206_high_12
Description: NF3206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3206_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 5e-84; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 18 - 179
Target Start/End: Complemental strand, 9319396 - 9319235
Alignment:
| Q |
18 |
caatccactcgcacacctgttgccataaagaagcaaacacagtacacgtaagaaaaagatgttctgctgtcttcaaaaattataatttgaattttattat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9319396 |
caatccactcgcacacctgttgccataaagaagcaaacacagtacacgtaagaaaaagatgttctgctgtcttcaaaaattataatttgaattttattat |
9319297 |
T |
|
| Q |
118 |
catatgattaaattgtgtcgccagaaaattataaaagataaaattaagtcattactttcaac |
179 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9319296 |
catatgattaaattgtgtcgcgagaaaattataaaagataaaattaagtcattactttcaac |
9319235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 268 - 330
Target Start/End: Complemental strand, 9320169 - 9320107
Alignment:
| Q |
268 |
ggccttcaatatccatttgcattgtcacatctctataaatagcatcccttaacacaagaaaaa |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9320169 |
ggccttcaatatccatttgcattgtcacatctctataaatagcatcccttaacacaagaaaaa |
9320107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 267 - 330
Target Start/End: Complemental strand, 9319147 - 9319084
Alignment:
| Q |
267 |
gggccttcaatatccatttgcattgtcacatctctataaatagcatcccttaacacaagaaaaa |
330 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9319147 |
gggccttcaatatccatttgcattaccacatctctataaatagcatcccttaacacaagaaaaa |
9319084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 100 - 179
Target Start/End: Complemental strand, 9320337 - 9320257
Alignment:
| Q |
100 |
taatttgaattttattatcata-tgattaaattgtgtcgccagaaaattataaaagataaaattaagtcattactttcaac |
179 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||| || |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9320337 |
taatttgaattttattatccttgtgattaaattgtgttgcgagaaaattatgaaagataaaattaagtcattactttcaac |
9320257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 9e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 268 - 330
Target Start/End: Complemental strand, 56023790 - 56023728
Alignment:
| Q |
268 |
ggccttcaatatccatttgcattgtcacatctctataaatagcatcccttaacacaagaaaaa |
330 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
56023790 |
ggccttccatgtccatttgcattgtcacatctctataaatagcctcccttaacgcaagaaaaa |
56023728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 89
Target Start/End: Complemental strand, 36228411 - 36228340
Alignment:
| Q |
18 |
caatccactcgcacacctgttgccataaagaagcaaacacagtacacgtaagaaaaagatgttctgctgtct |
89 |
Q |
| |
|
||||||| || | |||||||||||| | |||||||||||||||||||||||| |||||||| |||| ||||| |
|
|
| T |
36228411 |
caatccattcacgcacctgttgccaaagagaagcaaacacagtacacgtaaggaaaagatgctctgttgtct |
36228340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University