View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3206_low_16 (Length: 344)
Name: NF3206_low_16
Description: NF3206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3206_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 336
Target Start/End: Original strand, 31228515 - 31228851
Alignment:
| Q |
1 |
actgttgtgaatttctttgtca-cgtcatgcacgacttgtttgctattcatctcgaaaatcatattttgcaatcccgccgattctatccatgccattgat |
99 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |||||||| |||| ||||||||||||||||||||| | |
|
|
| T |
31228515 |
actgttgtgaatttctttgtcagcgtcatgcacgacctgtttgctattcatctcgaaaatcacattttgcagtcccaccgattctatccatgccattgct |
31228614 |
T |
|
| Q |
100 |
tgaattaaagctcaagcttcaccttcagctacacgctcgcggagcaccaatttgttttggctacaatgaatttaccatagtcatcccttgcacacatgcc |
199 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31228615 |
tgaattaaacctcaagcttcaccttcagctacacgctcgcggagcaccaatttgttttggctacaatgaatttaccatagtcatcccttgcacacatgcc |
31228714 |
T |
|
| Q |
200 |
aacacataaacactgctcatccgcaaaaaatgcagcatccagactgcattttacataactggtaggtagaggtatccaattttctgtcatgcgaacttct |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31228715 |
aacacataaacactgctcatccgcaaaaaatgcagcatccagactgcattttacataactggtaggtagaggtatccaattttctgtcatgcgaacttct |
31228814 |
T |
|
| Q |
300 |
ggctggtctgctccagctgatacacgctgcctttgct |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31228815 |
ggctggtctgctccagctgatacacgctgcctgtgct |
31228851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University