View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3208_high_21 (Length: 243)
Name: NF3208_high_21
Description: NF3208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3208_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 36 - 227
Target Start/End: Original strand, 40207784 - 40207975
Alignment:
| Q |
36 |
ctcgattctatgtttaatcatgcaccaattaggacccaatgttactacaggccattgagagtatttggctagaaatccaacaagatctactgatgaatca |
135 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40207784 |
ctcgattctatgtttaacctagcaccaattaggacccaatgttactgcaggccattgagagtatttggctagaaatccaacaacatctactgatgaatca |
40207883 |
T |
 |
| Q |
136 |
gcattatgttcaccccttgtatacaatattgacatatcatagatcatatagagtaacaagcaatcaaataactgacaataggacgataaatt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40207884 |
gcattatgttcaccccttgtatacaatattgacatatcatagatcatatagagtaacaagcaatcaaataactgacaataggacgataaatt |
40207975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University