View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3208_low_23 (Length: 238)
Name: NF3208_low_23
Description: NF3208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3208_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 3916498 - 3916718
Alignment:
| Q |
1 |
tgaattaaatttaccttatcttgaggaaattgatattagcaaaagttaatt-aaggtagctgaaaaacgtgttgcaagttgcaaccatggttttaaag-a |
98 |
Q |
| |
|
||||||||| |||| ||||| | ||||||||||| ||| |||| |||||| || ||||||||||||||||||||||| || |||||||||||||||| | |
|
|
| T |
3916498 |
tgaattaaaattacattatcgtaaggaaattgattttaacaaagcttaattgaaagtagctgaaaaacgtgttgcaagatgaaaccatggttttaaagta |
3916597 |
T |
 |
| Q |
99 |
ttaaggatcatagtttccttttacttatgttgtttaaggttgagcagtttttagttacataaggaataaatagaaagtaattaagttaaaggatagaata |
198 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| | |||| ||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3916598 |
ttaaggattttagtttccttttacttatgttgtttaaggttgacatgctttttgttacatgaggaataaatagaaagtaattatgttaaaggatagaata |
3916697 |
T |
 |
| Q |
199 |
actaatgaatgaatagaaata |
219 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3916698 |
actaatgaatgaatagaaata |
3916718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University