View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3208_low_27 (Length: 228)
Name: NF3208_low_27
Description: NF3208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3208_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 118 - 213
Target Start/End: Complemental strand, 10756636 - 10756541
Alignment:
| Q |
118 |
atttaagataataaaagtaaaaatgttagaaaaatttatacgctatgagctagtgaaaagtgtttttaatataatcgtataaatttatacaaagca |
213 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10756636 |
atttaagataataaaagtaaaaatgtcagaaaaatttatacgctatgagctagtgaaaagtgtttttaatataatcatataaatttatacaaagca |
10756541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 37 - 82
Target Start/End: Complemental strand, 10756717 - 10756672
Alignment:
| Q |
37 |
tttataatattagtcgttgaaagaaatgatacttataaaatgacaa |
82 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10756717 |
tttataaaattagtcgttgaaagacatgatacttataaaatgacaa |
10756672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University