View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3208_low_27 (Length: 228)

Name: NF3208_low_27
Description: NF3208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3208_low_27
NF3208_low_27
[»] chr3 (2 HSPs)
chr3 (118-213)||(10756541-10756636)
chr3 (37-82)||(10756672-10756717)


Alignment Details
Target: chr3 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 118 - 213
Target Start/End: Complemental strand, 10756636 - 10756541
Alignment:
118 atttaagataataaaagtaaaaatgttagaaaaatttatacgctatgagctagtgaaaagtgtttttaatataatcgtataaatttatacaaagca 213  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
10756636 atttaagataataaaagtaaaaatgtcagaaaaatttatacgctatgagctagtgaaaagtgtttttaatataatcatataaatttatacaaagca 10756541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 37 - 82
Target Start/End: Complemental strand, 10756717 - 10756672
Alignment:
37 tttataatattagtcgttgaaagaaatgatacttataaaatgacaa 82  Q
    ||||||| |||||||||||||||| |||||||||||||||||||||    
10756717 tttataaaattagtcgttgaaagacatgatacttataaaatgacaa 10756672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University