View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3210-Insertion-16 (Length: 184)
Name: NF3210-Insertion-16
Description: NF3210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3210-Insertion-16 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 2e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 2e-81
Query Start/End: Original strand, 12 - 184
Target Start/End: Original strand, 46838493 - 46838665
Alignment:
| Q |
12 |
catgtagtccggtgtaatgtttttatctccataaatttgtgaggttatctatcaatagtgtaacttagagacggatctactctaaagatattggggagag |
111 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |||||| |
|
|
| T |
46838493 |
catgtagtccggtgtaatgcttttatctccataaatttgtgaggttatctatcaatagtgtaacttagagatggatctactctatagatattgaggagag |
46838592 |
T |
|
| Q |
112 |
ctgaccccacaacttcaatctcttgttaaccaatattatgacattttgatgttataagccccagctcaaatag |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
46838593 |
ctgaccccacaacttcaatctcttgttaaccaatattatgatattttgatgttataagccccagctcaaatag |
46838665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 28; Significance: 0.0000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 122 - 165
Target Start/End: Original strand, 1916328 - 1916371
Alignment:
| Q |
122 |
aacttcaatctcttgttaaccaatattatgacattttgatgtta |
165 |
Q |
| |
|
|||||||||| ||||| |||||||| ||||| |||||||||||| |
|
|
| T |
1916328 |
aacttcaatcacttgtcaaccaataatatgatattttgatgtta |
1916371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University