View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3210-Insertion-17 (Length: 113)
Name: NF3210-Insertion-17
Description: NF3210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3210-Insertion-17 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 1e-51; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 7 - 113
Target Start/End: Complemental strand, 49438936 - 49438830
Alignment:
| Q |
7 |
acattgaatactcaatatgcccttgatagctttaacgagtttgtgcactccattctgctcaagctagattccatcaagagttttcacctcaaggttggat |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49438936 |
acattgaatactcaatatgcccttgatagctttaacgagtttgtgtactccattctgctcaagctagattccatcaagagttttcacctcaaggttggat |
49438837 |
T |
|
| Q |
107 |
atggtag |
113 |
Q |
| |
|
||||||| |
|
|
| T |
49438836 |
atggtag |
49438830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000001
Query Start/End: Original strand, 35 - 108
Target Start/End: Complemental strand, 49435065 - 49434992
Alignment:
| Q |
35 |
gctttaacgagtttgtgcactccattctgctcaagctagattccatcaagagttttcacctcaaggttggatat |
108 |
Q |
| |
|
|||| |||||||||||| |||| || || ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49435065 |
gcttcaacgagtttgtgtactctgttttgttcaagctagattccatcaagagtttctggctcaaggttggatat |
49434992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University