View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3210-Insertion-18 (Length: 92)
Name: NF3210-Insertion-18
Description: NF3210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3210-Insertion-18 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 4e-41; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 4e-41
Query Start/End: Original strand, 8 - 92
Target Start/End: Original strand, 2904656 - 2904740
Alignment:
| Q |
8 |
ccttgtggagctgggacagtctatattagattaactttcagtggggcgttggatttggcggctgtttttggtaacaatgagctag |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2904656 |
ccttgtggagctgggacagtctatattagattaactttcagtggggcgttggatttggcggctgtttttggtaacaatgagctag |
2904740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 77; E-Value: 2e-36
Query Start/End: Original strand, 8 - 92
Target Start/End: Original strand, 2852624 - 2852708
Alignment:
| Q |
8 |
ccttgtggagctgggacagtctatattagattaactttcagtggggcgttggatttggcggctgtttttggtaacaatgagctag |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2852624 |
ccttgtggagctgggacagtctatattagattaattttcagtggggcgttggatttggcggctgtttttggtaacaatgtgctag |
2852708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.000000000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.000000000000007
Query Start/End: Original strand, 35 - 83
Target Start/End: Original strand, 42951034 - 42951082
Alignment:
| Q |
35 |
agattaactttcagtggggcgttggatttggcggctgtttttggtaaca |
83 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42951034 |
agattaaatttcagtggagcgttggatttggcggctgtttttggtaaca |
42951082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University