View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3210-Insertion-18 (Length: 92)

Name: NF3210-Insertion-18
Description: NF3210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3210-Insertion-18
NF3210-Insertion-18
[»] chr8 (2 HSPs)
chr8 (8-92)||(2904656-2904740)
chr8 (8-92)||(2852624-2852708)
[»] chr5 (1 HSPs)
chr5 (35-83)||(42951034-42951082)


Alignment Details
Target: chr8 (Bit Score: 85; Significance: 4e-41; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 85; E-Value: 4e-41
Query Start/End: Original strand, 8 - 92
Target Start/End: Original strand, 2904656 - 2904740
Alignment:
8 ccttgtggagctgggacagtctatattagattaactttcagtggggcgttggatttggcggctgtttttggtaacaatgagctag 92  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2904656 ccttgtggagctgggacagtctatattagattaactttcagtggggcgttggatttggcggctgtttttggtaacaatgagctag 2904740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 77; E-Value: 2e-36
Query Start/End: Original strand, 8 - 92
Target Start/End: Original strand, 2852624 - 2852708
Alignment:
8 ccttgtggagctgggacagtctatattagattaactttcagtggggcgttggatttggcggctgtttttggtaacaatgagctag 92  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||    
2852624 ccttgtggagctgggacagtctatattagattaattttcagtggggcgttggatttggcggctgtttttggtaacaatgtgctag 2852708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 41; Significance: 0.000000000000007; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.000000000000007
Query Start/End: Original strand, 35 - 83
Target Start/End: Original strand, 42951034 - 42951082
Alignment:
35 agattaactttcagtggggcgttggatttggcggctgtttttggtaaca 83  Q
    ||||||| ||||||||| |||||||||||||||||||||||||||||||    
42951034 agattaaatttcagtggagcgttggatttggcggctgtttttggtaaca 42951082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University