View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3210-Insertion-19 (Length: 85)
Name: NF3210-Insertion-19
Description: NF3210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3210-Insertion-19 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 74; Significance: 1e-34; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 74; E-Value: 1e-34
Query Start/End: Original strand, 12 - 85
Target Start/End: Original strand, 8096197 - 8096270
Alignment:
| Q |
12 |
tttcatccagagtaagtcaatttaaacaacattttgtgtttttcttcctttttcttccttcatattgatgttta |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8096197 |
tttcatccagagtaagtcaatttaaacaacattttgtgtttttcttcctttttcttccttcatattgatgttta |
8096270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University