View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3210_low_3 (Length: 374)
Name: NF3210_low_3
Description: NF3210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3210_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 24 - 353
Target Start/End: Original strand, 8467380 - 8467709
Alignment:
| Q |
24 |
ctagtatgcttgtgtgcagtgtcagagcttaatttgtgaaaatagcttgttctattttattaataattcatttattatttcatacaatcaccattgtatg |
123 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8467380 |
ctagtatggttgtgtgcagtgtcagagcttaatttgtgaaaatagcttgttctattttattaataattcatttattatttcatacaatcaccattgtatg |
8467479 |
T |
|
| Q |
124 |
catataatccatcttgtttgatgaaaaccctagctagcagctggtttatgttttcctactttcccatgcctttattttctagtaatttattcttggatga |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8467480 |
catataatccatcttgtttgatgaaaaccctagctagcagctggtttatgttttcctactttcccatgcctttattttctagtaatttattcttggatga |
8467579 |
T |
|
| Q |
224 |
ggctaggtttacattagaagaggctcatattatatctatggtgatcagatcagcgaggttgggggaaattagttttctatttttctttactttaccaaac |
323 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8467580 |
ggctaggtttacattagaagaggctcatcttatatctatggtgatcagatcagcgaggttgggggaaattagttttctatttttctttactttaccaaac |
8467679 |
T |
|
| Q |
324 |
aaattattaagtcaagttttttgtttccta |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
8467680 |
aaattattaagtcaagttttttgtttccta |
8467709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University