View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3210_low_7 (Length: 232)
Name: NF3210_low_7
Description: NF3210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3210_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 35060292 - 35060080
Alignment:
| Q |
1 |
ttggttattgatatggttactataaccatgaaagtagtaatagagaatatcaaacactgtggcgggttcaatccagagtttagctgagcggaggttgaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35060292 |
ttggttattgatatggttactataaccatgaaagtagtaatagagaatatcaaacactgtggcgggttcaatccagagtttagctgagcggaggttgaaa |
35060193 |
T |
|
| Q |
101 |
ccacgagcaactcgtggagcccaaggaatgattatggtgtagagtaagcaagtgaaaggtttggattcttgtttggcagagagtatgagattggtgatga |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35060192 |
ccacgagctactcgtggagcccaaggaatgattatggtgtagagtaagcaagtgaaaggtttggattcttgtttggcagagagtatgagattggtgatga |
35060093 |
T |
|
| Q |
201 |
agtcggagccacg |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35060092 |
agtcggagccacg |
35060080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University