View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3211_high_20 (Length: 292)
Name: NF3211_high_20
Description: NF3211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3211_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 283
Target Start/End: Complemental strand, 39585957 - 39585693
Alignment:
| Q |
18 |
tgttggacctaatagttgattccaaccatcacggctaaacttttcttagatgtctggaaaaattttgtgtggagatgcatgtccctggctcttgaaactg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39585957 |
tgttggacctaatagttgattccaaccatcacggctaaacttttcttagatgtctggaaaaaatttgtgtggagatgcatgtccctggctcttgaaactg |
39585858 |
T |
|
| Q |
118 |
aactctaactatggccaaatggttaaacattaattccacctttgccgtttgattgagaagnnnnnnnnnnnnnnnttcaaggaacatgacatcattgaca |
217 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
39585857 |
aactctaactatgggcaaatggttaaacattaattccacctttgccgtttgattgagaag-aaaaaaatatataattcaaggaacatgacaccattgaca |
39585759 |
T |
|
| Q |
218 |
tgagagtgagaccgtaggagacatttattgattttgacaatttgcataagtttgccatgagttagc |
283 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39585758 |
tgagagtgagaccgtaggagtcatttattgattttgacaatttgcataagtttggcatgagttagc |
39585693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University