View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3211_high_22 (Length: 273)
Name: NF3211_high_22
Description: NF3211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3211_high_22 |
 | |
|
| [»] scaffold1432 (1 HSPs) |
| | |
|
| [»] scaffold0236 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold1432 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: scaffold1432
Description:
Target: scaffold1432; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 1598 - 1334
Alignment:
| Q |
1 |
tttagtagtttgtatcgggtgtgtttggtatttgaaagtgacttggtttagtagtacagtattttgagtaattggattatagcggctttagctaaattca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1598 |
tttagtagtttgtatcgggtgtgtttggtatttgaaagtgacttggtttagtagtacagtattttgagtaattggattatagcggctttagctaaattca |
1499 |
T |
|
| Q |
101 |
gcatcctcttggccttacaagtaaaatttctaacaataaaaataaccgaaccctatcctttctcaatctctgctcttccattctcttcgaaatctagtgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
1498 |
gcatcctcttggccttacaagtaaaatttcaaacaataaaaataaccgaaccctatcctctctcaatctctgctcttccattctctttgacatctagtgt |
1399 |
T |
|
| Q |
201 |
acgttggcggcgtttcaagttgccattccatgtatacgacacttctctatgcacgatttcatctc |
265 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1398 |
acgttggcgccttttcaagttgccattccatgtatacgacacttctctatgcgcgatttcatctc |
1334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0236 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: scaffold0236
Description:
Target: scaffold0236; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 21780 - 22025
Alignment:
| Q |
1 |
tttagtagtttgtatcgggtgtgtttggtatttgaaagtgacttggtttagtagtacagtattttgagtaattggattatagcggctttagctaaattca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21780 |
tttagtagtttgtatcgggtgtgtttggtatttgaaagtgatttggtttact-----agtattttgagtaattggattatagcggctttagctaaattca |
21874 |
T |
|
| Q |
101 |
gcatcctcttggccttacaagtaaaatttctaacaataaaaataaccgaaccctatcctttctcaatctctgctcttccattctcttcgaaatctagtgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||||| ||||||||| ||| ||| ||||||||| |
|
|
| T |
21875 |
ccatcctcttggccttacaagtaaaatttcaaacaataaaaataactgaaccctagtctttctcaatctctgatcttccattttctacgacatctagtgt |
21974 |
T |
|
| Q |
201 |
acgttggcggcgtttcaagttgccattccatgtatacgacacttctctatg |
251 |
Q |
| |
|
||||| | | | ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
21975 |
acgttagtgccttttcaagttgccattccatgtgcacgacacttctctatg |
22025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University