View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3211_high_42 (Length: 216)
Name: NF3211_high_42
Description: NF3211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3211_high_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 41482836 - 41483036
Alignment:
| Q |
1 |
attttacatctaaagtcaccgctatcttatgattatttacgaccgacattcttgattgtgttaacattgttgagcaatatcagaagcacagaaattggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
41482836 |
attttacatctaaagtcaccgctatcttatgattatttacgaccgacattcttgattgcgttaacattgttgagctatatcagaagcacagaaataggat |
41482935 |
T |
 |
| Q |
101 |
tctagtggacggccattaaagtggcagatggaaccaaattggaaaataaaaaattaaggcccacccaaaccctcaagtccctctcaacttcacgtcttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41482936 |
tctagtggacggccattaaagtggcagatgaaaccaaattggaaaataaaaaattaaggcccacccaaaccctcaagtccctctcaacttcacgtcttca |
41483035 |
T |
 |
| Q |
201 |
t |
201 |
Q |
| |
|
| |
|
|
| T |
41483036 |
t |
41483036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University