View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3211_low_14 (Length: 379)
Name: NF3211_low_14
Description: NF3211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3211_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 11 - 317
Target Start/End: Original strand, 8062761 - 8063067
Alignment:
| Q |
11 |
cagagacaaagaaattacgatgttttggattggtaagaaagggaagttgaaactgctgaaattcttgctttattatatcatcgtttatctttgttgagta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8062761 |
cagagacaaagaaattacgatgttttggattggtcagaaagggaagttgaaactgctgaaattcttgctttattatatcatcgtttctctttgttgagta |
8062860 |
T |
 |
| Q |
111 |
gagtaacatactcatgggggtgtaaaaagcagagatctgcaattcaaaacaacccttcttcttatggcggcgccgccgttcttcctccttctgctgatgc |
210 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8062861 |
gtgtaacatactcatgggggtgtaaaaagcagagatctgcaattcaaaacaacccttcttcttatggcggcgccgccgttcttcctccttcttctgatgc |
8062960 |
T |
 |
| Q |
211 |
cggaaaagctcaagcttcaagtcctgctacccctctttcatttccagccactgaatcagatgacaaaactaaacctttcaaaaacaaagtttctctcaaa |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8062961 |
cggaaaagctcaagcttcaagtcctgctacccctctttcatttccagccactgaatcagatgacaaaactaaacctttcaaaaacaaagtttctctcaaa |
8063060 |
T |
 |
| Q |
311 |
agggtaa |
317 |
Q |
| |
|
||||||| |
|
|
| T |
8063061 |
agggtaa |
8063067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University