View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3211_low_25 (Length: 265)
Name: NF3211_low_25
Description: NF3211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3211_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 6 - 225
Target Start/End: Complemental strand, 43416606 - 43416387
Alignment:
| Q |
6 |
gtccaagaatatggttgtcaaaatataccatcctgccttccatcactcatcattgtgaagctactttgttaaggcctggccccgcactgaaactaatctc |
105 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43416606 |
gtccaaaaatatggttgtcaaaagataccatcctgccttccatcactcatcattgtgaagctactttgttaaggcctggccccgcactgaaactaatctc |
43416507 |
T |
 |
| Q |
106 |
tcttgggtaatcaaccatggtcacataatatcgatgaggtagtggaatcggcgacctcaaactcaaagattatatgattcccttcgatggaagtaactaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43416506 |
tcttgggtaatcaaccatggtcacataatatcgatgaggtagtggaatgccggacctcaaactcgaagattatatgattcccttcgatggaagtaactaa |
43416407 |
T |
 |
| Q |
206 |
atttacaataacttcatact |
225 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
43416406 |
atttacaataacttcatact |
43416387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University