View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3211_low_35 (Length: 241)
Name: NF3211_low_35
Description: NF3211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3211_low_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 153 - 225
Target Start/End: Complemental strand, 3500143 - 3500071
Alignment:
| Q |
153 |
ttggattcctgagacagtaaagtgagtattctatcgctattgattctctagtacatacattttcacttctgaa |
225 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3500143 |
ttggattcctgagatagtagagtgagtattctatcgctattgattctctagtacatacattttcacttctgaa |
3500071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 3500275 - 3500148
Alignment:
| Q |
1 |
aacaagcaggcacggtatgaggaccagaaggtgatttatgaagatttaagtgatagaaa---------------aagttggattcttttgtatttgttcc |
85 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||| || |||||||| |||||||||||||||||||||||||| |
|
|
| T |
3500275 |
aacaagcaggcaaggtatgagaaccagaaggtgatttatgaagatttgagagatagaaattgtttatatcagaaaagttggattcttttgtatttgttcc |
3500176 |
T |
 |
| Q |
86 |
cgttcaccattttgtacttcttgtataa |
113 |
Q |
| |
|
||||||||| |||||||||||||||||| |
|
|
| T |
3500175 |
cgttcaccactttgtacttcttgtataa |
3500148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University